ID: 1104662444_1104662458

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1104662444 1104662458
Species Human (GRCh38) Human (GRCh38)
Location 12:130620891-130620913 12:130620928-130620950
Sequence CCACCCCACCCAGCAGTGGTGAG AGACCTGGACTCCGGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 488} {0: 1, 1: 0, 2: 2, 3: 27, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!