ID: 1104663314_1104663319

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104663314 1104663319
Species Human (GRCh38) Human (GRCh38)
Location 12:130628054-130628076 12:130628087-130628109
Sequence CCATCTGTGCTCCAGACACCCAG ATCAAGTTCTTTCTTGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 415} {0: 1, 1: 0, 2: 6, 3: 66, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!