ID: 1104665054_1104665063

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1104665054 1104665063
Species Human (GRCh38) Human (GRCh38)
Location 12:130641929-130641951 12:130641973-130641995
Sequence CCACCCTGACTCTATAGATAAGC GAGAAAACTGAGGCAACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 1, 2: 27, 3: 338, 4: 1959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!