ID: 1104666364_1104666380

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1104666364 1104666380
Species Human (GRCh38) Human (GRCh38)
Location 12:130650045-130650067 12:130650094-130650116
Sequence CCTGAGGACCTGCTCCTCCAGTG TGGGGACTCGCAGGCAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 236} {0: 1, 1: 0, 2: 0, 3: 12, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!