ID: 1104676369_1104676377

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1104676369 1104676377
Species Human (GRCh38) Human (GRCh38)
Location 12:130714755-130714777 12:130714777-130714799
Sequence CCTCCGGAGCCGGTCAGACCCTG GCCCATCCCACTGGGAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111} {0: 1, 1: 0, 2: 3, 3: 37, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!