ID: 1104691262_1104691268

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104691262 1104691268
Species Human (GRCh38) Human (GRCh38)
Location 12:130828094-130828116 12:130828125-130828147
Sequence CCCATCTCCATCAGAAGACCCTA ATATTTATCAGTGTTTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143} {0: 1, 1: 0, 2: 2, 3: 53, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!