ID: 1104691905_1104691916

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104691905 1104691916
Species Human (GRCh38) Human (GRCh38)
Location 12:130832874-130832896 12:130832905-130832927
Sequence CCCTCCCCCAGCCCTGTCCACAG TTATCCACAGCTCAGCTCACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 151, 4: 1079} {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!