ID: 1104718264_1104718268

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1104718264 1104718268
Species Human (GRCh38) Human (GRCh38)
Location 12:131030596-131030618 12:131030611-131030633
Sequence CCGGACGAGGGGTCTCTTCAGCT CTTCAGCTGCACATCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74} {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!