ID: 1104719964_1104719971

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1104719964 1104719971
Species Human (GRCh38) Human (GRCh38)
Location 12:131039740-131039762 12:131039766-131039788
Sequence CCCAGGCTCACGCTGGGAAAGGG AGACTCAGCTGGGCCCAAACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 183} {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!