ID: 1104722581_1104722585

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1104722581 1104722585
Species Human (GRCh38) Human (GRCh38)
Location 12:131053168-131053190 12:131053205-131053227
Sequence CCTTCTGGTAGCTCTTTCTCTGA TCACTGTGATGACGGAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 322} {0: 1, 1: 0, 2: 2, 3: 14, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!