ID: 1104723639_1104723651

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1104723639 1104723651
Species Human (GRCh38) Human (GRCh38)
Location 12:131061154-131061176 12:131061201-131061223
Sequence CCGCCCAGCCTCTCAAGGTGATG GTTCCCACCCCCAGTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 211, 4: 2316} {0: 1, 1: 3, 2: 2, 3: 31, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!