ID: 1104729067_1104729074

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1104729067 1104729074
Species Human (GRCh38) Human (GRCh38)
Location 12:131095034-131095056 12:131095064-131095086
Sequence CCTGTGGCCTGTGCCTCTCTGAG CTGAGTGAGCCCTGGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 339} {0: 1, 1: 0, 2: 0, 3: 35, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!