ID: 1104735714_1104735718

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1104735714 1104735718
Species Human (GRCh38) Human (GRCh38)
Location 12:131134991-131135013 12:131135040-131135062
Sequence CCTGGGCAGCAGGAACTCCGCTA AAGGCAGAAGGTCCCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 4, 3: 26, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!