ID: 1104772910_1104772916

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1104772910 1104772916
Species Human (GRCh38) Human (GRCh38)
Location 12:131375446-131375468 12:131375490-131375512
Sequence CCATCTTCCTTCTGGGCACAGTG AGTTGGCATGAGAATGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!