ID: 1104803285_1104803305

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1104803285 1104803305
Species Human (GRCh38) Human (GRCh38)
Location 12:131569347-131569369 12:131569400-131569422
Sequence CCCTCCTCCCTCCCTCTCCTCAG AGCAGCCCCAGGGTCTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 46, 3: 663, 4: 4667} {0: 1, 1: 0, 2: 1, 3: 15, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!