ID: 1104808901_1104808909

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104808901 1104808909
Species Human (GRCh38) Human (GRCh38)
Location 12:131608168-131608190 12:131608207-131608229
Sequence CCTTCAAGTTGTTTTCCAGACTT CGGATTCCAGCAGTGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 39, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!