ID: 1104811301_1104811306

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1104811301 1104811306
Species Human (GRCh38) Human (GRCh38)
Location 12:131621890-131621912 12:131621918-131621940
Sequence CCGCAGCTCCTGCACTCCACGGA GCCTGGCCACACTCCCTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 259} {0: 1, 1: 0, 2: 4, 3: 42, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!