ID: 1104813605_1104813617

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104813605 1104813617
Species Human (GRCh38) Human (GRCh38)
Location 12:131633458-131633480 12:131633491-131633513
Sequence CCTGGGGTCTGTGCTGACTCCCA CATCTCTTGGGGGGGTCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 24, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!