ID: 1104825930_1104825936

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1104825930 1104825936
Species Human (GRCh38) Human (GRCh38)
Location 12:131709876-131709898 12:131709894-131709916
Sequence CCCAACAATGTCCCTGATCTCTT CTCTTAAAGCTAATTCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 187} {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!