ID: 1104835153_1104835162

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1104835153 1104835162
Species Human (GRCh38) Human (GRCh38)
Location 12:131785326-131785348 12:131785377-131785399
Sequence CCTGGCCCTCCAGGATGCCGGGG AGCACAGCCTGTGGCATTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 433} {0: 1, 1: 0, 2: 4, 3: 29, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!