ID: 1104837577_1104837578

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1104837577 1104837578
Species Human (GRCh38) Human (GRCh38)
Location 12:131801519-131801541 12:131801534-131801556
Sequence CCGTGGCTCGTGTTTGCCATGGC GCCATGGCCCGTGTTTGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 7, 3: 62, 4: 486} {0: 1, 1: 3, 2: 4, 3: 7, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!