ID: 1104841521_1104841529

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1104841521 1104841529
Species Human (GRCh38) Human (GRCh38)
Location 12:131828234-131828256 12:131828257-131828279
Sequence CCTTCCCTGTGATGCCGCGGACC CAGTCCCGTCGCGGACACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80} {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!