ID: 1104843649_1104843668

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1104843649 1104843668
Species Human (GRCh38) Human (GRCh38)
Location 12:131836113-131836135 12:131836163-131836185
Sequence CCCAGTTCTGTACACACTCTTGG TGGGTCAGTAGGGTTTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109} {0: 1, 1: 0, 2: 1, 3: 18, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!