ID: 1104846287_1104846294

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104846287 1104846294
Species Human (GRCh38) Human (GRCh38)
Location 12:131848718-131848740 12:131848757-131848779
Sequence CCTCGGGGCTCATACACGCGGTG CCTTCCTGGCTGAGGCTGAGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 27} {0: 1, 1: 0, 2: 2, 3: 38, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!