ID: 1104859211_1104859225

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1104859211 1104859225
Species Human (GRCh38) Human (GRCh38)
Location 12:131916034-131916056 12:131916069-131916091
Sequence CCACAGGCCAGCCCTCCCCAGCC GCAGTCCTGCCGGAACCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 179, 4: 1296} {0: 1, 1: 0, 2: 0, 3: 16, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!