ID: 1104859891_1104859903

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1104859891 1104859903
Species Human (GRCh38) Human (GRCh38)
Location 12:131918410-131918432 12:131918446-131918468
Sequence CCTGGAGGTGTGGGAGTCTGTGG GCCACGGTGTCTGCTGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 348} {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!