|
Left Crispr |
Right Crispr |
| Crispr ID |
1104875696 |
1104875707 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:132033068-132033090
|
12:132033118-132033140
|
| Sequence |
CCCCCGAGGAGCTGAGGTTACAG |
TTGTATTTTTAGTAGAAACGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 134, 3: 1700, 4: 6613} |
{0: 3229, 1: 107794, 2: 221738, 3: 148056, 4: 77067} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|