ID: 1104877246_1104877258

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1104877246 1104877258
Species Human (GRCh38) Human (GRCh38)
Location 12:132044168-132044190 12:132044221-132044243
Sequence CCCCGTCAGGACGCAGTGATGAC GAAGACCCTGCAGGAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69} {0: 1, 1: 0, 2: 7, 3: 55, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!