ID: 1104882763_1104882769

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104882763 1104882769
Species Human (GRCh38) Human (GRCh38)
Location 12:132084095-132084117 12:132084128-132084150
Sequence CCACGTGCGAATGAATGAACAAA GCGGAGCCAGAGGCGCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111} {0: 1, 1: 0, 2: 3, 3: 44, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!