ID: 1104885521_1104885539

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1104885521 1104885539
Species Human (GRCh38) Human (GRCh38)
Location 12:132104859-132104881 12:132104900-132104922
Sequence CCCTGGGCTTCGAGAGGACGCCC GCTGGGGGCGCAGCGGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 67} {0: 2, 1: 0, 2: 3, 3: 42, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!