ID: 1104902540_1104902550

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1104902540 1104902550
Species Human (GRCh38) Human (GRCh38)
Location 12:132197226-132197248 12:132197268-132197290
Sequence CCGTGGCCCGGCTCACAATGGGG ACATCAAGTCAGCCAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 130} {0: 1, 1: 0, 2: 1, 3: 14, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!