ID: 1104904203_1104904215

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1104904203 1104904215
Species Human (GRCh38) Human (GRCh38)
Location 12:132204841-132204863 12:132204888-132204910
Sequence CCCAAGCTCCGCCGTGCTCAGGT GGACGAGTGTGCCAGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56} {0: 1, 1: 0, 2: 0, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!