|
Left Crispr |
Right Crispr |
| Crispr ID |
1104911077 |
1104911086 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:132241216-132241238
|
12:132241248-132241270
|
| Sequence |
CCTTCCAGGGGCCCTCCCTATAC |
ACACGCCACACCCCCTTCCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 37, 2: 11, 3: 17, 4: 150} |
{0: 29, 1: 9, 2: 8, 3: 35, 4: 272} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|