ID: 1104912289_1104912294

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1104912289 1104912294
Species Human (GRCh38) Human (GRCh38)
Location 12:132245065-132245087 12:132245105-132245127
Sequence CCTTGTCAGGGGATGAAGGTGAA ACACAGGCTCCCCTGCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176} {0: 1, 1: 0, 2: 4, 3: 24, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!