ID: 1104914741_1104914753

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1104914741 1104914753
Species Human (GRCh38) Human (GRCh38)
Location 12:132258795-132258817 12:132258847-132258869
Sequence CCTTGGAGACGCCATGGTCTACC GTCCACGCTGGAGACCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60} {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!