ID: 1104915021_1104915031

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104915021 1104915031
Species Human (GRCh38) Human (GRCh38)
Location 12:132260128-132260150 12:132260167-132260189
Sequence CCCCAACTCTAATGACAAGGGTC ATGGAGAAACAGACACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223} {0: 1, 1: 1, 2: 13, 3: 121, 4: 887}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!