ID: 1104915584_1104915592

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1104915584 1104915592
Species Human (GRCh38) Human (GRCh38)
Location 12:132262759-132262781 12:132262789-132262811
Sequence CCATAGCTCATCTGTCTGCACCT ACACGGTTTGGGGTGTGGTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 212} {0: 1, 1: 2, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!