ID: 1104928552_1104928567

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1104928552 1104928567
Species Human (GRCh38) Human (GRCh38)
Location 12:132326543-132326565 12:132326584-132326606
Sequence CCCCACCCCAGTGGCCCTCCCGC GACGTGGACTTCCTTCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 391} {0: 1, 1: 0, 2: 1, 3: 9, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!