ID: 1104929163_1104929178

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104929163 1104929178
Species Human (GRCh38) Human (GRCh38)
Location 12:132329251-132329273 12:132329290-132329312
Sequence CCCGCCCGGGCCTGGGCTTCAGC ATGAGCCGCCCGGGGCTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 444} {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!