ID: 1104954361_1104954369

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1104954361 1104954369
Species Human (GRCh38) Human (GRCh38)
Location 12:132457231-132457253 12:132457250-132457272
Sequence CCCGGACGGGCCACTCCTGGGGC GGGCTGACGAGGCAGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 200} {0: 1, 1: 0, 2: 6, 3: 93, 4: 1836}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!