ID: 1104954943_1104954956

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104954943 1104954956
Species Human (GRCh38) Human (GRCh38)
Location 12:132459792-132459814 12:132459825-132459847
Sequence CCCCCTTTCGCACCTCTATCCCA CCCTGGCCTTGCCACCATGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 198} {0: 1, 1: 0, 2: 0, 3: 35, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!