ID: 1104969411_1104969421

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1104969411 1104969421
Species Human (GRCh38) Human (GRCh38)
Location 12:132524419-132524441 12:132524450-132524472
Sequence CCGTCTGCCTTGTGTGCACCCTG CCAGGGAGGCCTGTTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 327} {0: 1, 1: 0, 2: 4, 3: 36, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!