ID: 1104971891_1104971900

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1104971891 1104971900
Species Human (GRCh38) Human (GRCh38)
Location 12:132534533-132534555 12:132534554-132534576
Sequence CCCTGCCCCACATGTGCCCACAC ACAGGGCTCACTTCCCGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 354} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!