ID: 1105000341_1105000363

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1105000341 1105000363
Species Human (GRCh38) Human (GRCh38)
Location 12:132686844-132686866 12:132686889-132686911
Sequence CCCCCAGGCAGGGTCCCCGGCCC AGCCGCGCGTCCACCCCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 56, 4: 395} {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!