ID: 1105027152_1105027161

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1105027152 1105027161
Species Human (GRCh38) Human (GRCh38)
Location 12:132856911-132856933 12:132856945-132856967
Sequence CCTCACTTGTCTGGGTGCTGGTG CTCGCTTGCCCAGGTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 195} {0: 1, 1: 0, 2: 9, 3: 18, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!