ID: 1105039341_1105039347

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105039341 1105039347
Species Human (GRCh38) Human (GRCh38)
Location 12:132949524-132949546 12:132949539-132949561
Sequence CCGGACTTTGGGTACCCTACGGG CCTACGGGTGGTGTTGAGGCTGG
Strand - +
Off-target summary {0: 9, 1: 12, 2: 9, 3: 12, 4: 41} {0: 16, 1: 26, 2: 15, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!