ID: 1105039345_1105039349

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1105039345 1105039349
Species Human (GRCh38) Human (GRCh38)
Location 12:132949538-132949560 12:132949560-132949582
Sequence CCCTACGGGTGGTGTTGAGGCTG GGTCCCCAACAGTATCTGCAGGG
Strand - +
Off-target summary {0: 18, 1: 22, 2: 14, 3: 7, 4: 90} {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!