ID: 1105044040_1105044054

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1105044040 1105044054
Species Human (GRCh38) Human (GRCh38)
Location 12:132986788-132986810 12:132986822-132986844
Sequence CCGCAGCCCGCGGGTCCTGCCCC CGCGAACGTGGGCGTGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 420} {0: 1, 1: 0, 2: 4, 3: 5, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!