ID: 1105044041_1105044050

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1105044041 1105044050
Species Human (GRCh38) Human (GRCh38)
Location 12:132986794-132986816 12:132986811-132986833
Sequence CCCGCGGGTCCTGCCCCCGCAGG CGCAGGCAGCGCGCGAACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207} {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!