ID: 1105045764_1105045770

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1105045764 1105045770
Species Human (GRCh38) Human (GRCh38)
Location 12:133002009-133002031 12:133002055-133002077
Sequence CCCGCTTCCCTTTCTTCTCACGT CCTTCAGTGACTCACTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 456} {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!